martes, 21 de julio de 2009

Muffins de zanahoria

La zanahoria da muy buen resultado en repostería, prueba de ello es las innumerables recetas que hay de tartas, bizcochos y muffins de zanahorias.
Esta receta es del blog de Cerise. Me gustan los bizcochos o muffins que llevan frutas o en este caso la zanahoria porque aguantan días tiernos, bueno si eres capaz de no comértelos para comprobarlo.

Ingredientes:

- 200 gr. harina.
- 160 gr. de azúcar.
- 1 sobre levadura química.
- 1 cucharita café de bicarbonato.
-1cucharita café de canela.
- una pizca de sal.
- 2 huevos.
- 120ml aceite de girasol.
- 120 ml de leche.
- 150 g de zanahorias ralladas.
-1 sobre de vainilla azucarada.


Instrucciones:

Mezclar en un bol la harina, el azúcar, la levadura, el bicarbonato, la canela, la vainilla, la sal y la zanahoria .
En otro bol batir los huevos y mezclar con el aceite y la leche.
Unir los ingredientes secos con los húmedos, y verter la mezcla en moldes de magdalenas.
Llevar al horno a 180º durante unos 35 minutos.

29 comentarios:

Missis dijo...

Susana, que pinta mas rica....estoy que no cocino apenas, solo tengo una cosa por subir y hasta septiembre igual ni puedo por el dichoso ordenata, os leo según me dejan un ordenador u otro. Besos Carmina.

Eva dijo...

qué cosa más rica!!!! me llevo esta receta de deberes para el verano!!! me han cogido ganas de prepararla hoy mismo!
bs!!

Marymary dijo...

Tienen un pinta genial! desde luego lo que no se te ocurra a ti... jaja
Un besito

Alicia (canelona) dijo...

¿Es que en tu casa no se come normal? un puchero, unos macarrones, jajajaja. Estas que te sales ultimamente con las fotos y los picoteos de tus recetas, que buenossssss!!

Empar dijo...

Te han quedado estupendos!!!
Pues la verdad no creo que durasen nada tampoco en casa......... por eso mejor no los hago,...... pegarte la paliza para que desaparezcan enseguida. jajaja
Un beso.

María Lunarillos dijo...

Susuna, qué color tan bonito, que flor de zanahoria tan bonita y qué papelitos para los muffin tan bonitos!!! Imagino su sabor, la zanahoria siempre hace que los dulces sean especiales.

Un besote.

Claudia Luisa Debelius dijo...

GUUUUUUAAAAAAAUUUUUUUU!
¡Qué preciosidad!
Y de sabor seguro,seguro que exquisitos!
Me dejas con la boca abierta!.......
Un beso.

Anónimo dijo...

Su, que guay y menuda pinta estos mufins, mira que yo queria hacer la tarta de zanahoria, pero así me apetecen más, me encantan las fotos como siempre preciosas, bsss

laviana ( Fely) dijo...

Menuda pintaza!!! si invitan a comer yaaa!!! me gusta...así que me la copio wapa.
besinos.

Morguix dijo...

Qué jugositos y qué ricos se ven.
Un besazo, guapa.

Anónimo dijo...

¡Qué buena pinta Susana! Me sumo a todos los piropos que te han dicho.
¡Estás que te sales!

Un beso guapa,

Sol

SANDY dijo...

Que pinta tan rica tiene y que bien decorada con su flor de zanahoria.
Un beso.

fargopatt dijo...

ooooooooooooooooooooooooooooh!! qué envidia!!! me encantan todas las cosas dulces con zanahorias.... lo dicho..que me esperes que me paso a buscar los mios..jajajaj

besitos wapa

Mar dijo...

Me encanta el bizcocho de zanahoria, así que imagino que estará divino...
Un beso

ADELA dijo...

Que buena pinta hija, todo lo haces buenísimo y claro está, me obligas a ponerme manos en la masa.
He hecho muchas recetas tuyas, la última los muffins de frutos del bosque...hummm¡¡¡ Sin comentarios.
Un besote

Anónimo dijo...

Buenas noches bloger@s:

Os escribo para comunicaros un reciente fraude o delito en la comunidad Blogger-culinaria.
Este delito se trata de atribuirse o adjudicarse recetas que no han sido elaboradas por los seud@s cociner@s, con el agravante de poseer una licencia “Creative Commons Reconocimiento-No comercial-Sin obras derivadas 3.0 España License”, considerándose ello, un motivo más para salvaguardar y defender los derechos a continuación expuestos.
Este delito, tipificado en el Real Decreto Legislativo 1/1996 y en su reciente Ley 23/2006, de 7 de junio, por la cual, se reconoce “La propiedad intelectual de una obra literaria, artística o científica corresponde al autor por el solo hecho de su creación”.
Esta Ley, a sido vulnerada en la dirección: http://lasrecetasdecasaclaudia.blogspot.com/search/label/Reposter%C3%ADa

Esta receta, tanto fotografía como elaboración (redacción como explicación), se encuentran el la Pág. 69 del volumen “El gran libro de la Repostería” de Christian Teubner y Annete Wolter, de la editorial Everest.

Este fragante delito, es una vulneración a la confianza de l@s demás bloger@s que con trabajo y tesón, elaboran por si mismos sus recetas. Algunas mejores, otras, a lo mejor no tanto, pero seguramente, todas rebosantes de ilusión y cariño, para luego, compartir de forma altruista con el resto de bloger@s.

No debemos de permitir Actos como este, dado que con ello, se rompería la mágica de nuestros blogs culinarios. Todo nuestro trabajo y esfuerzo, sería en balde.

Desde aquí, hago un llamamiento para que entre tod@s, hagamos una blogosfera culinaria más legal, libre de falsedad, mentiras e hipocresías.

Ernestina tina777 dijo...

uhmmmm deliciosos esos muffins con lo rica que es la zanahoria y el saborcito rico que les da.
Besos.

Laura. dijo...

Que delicia, se ven super jugosos, te han quedao bien altitos, me encantan! Besos!

Maria Dolores dijo...

Susana me encantan los dulces con zanahoria y viendo como te han quedado seguro que te los copiaré, será cuando me deslie que estoy aún muy liada.
Besos

Celes dijo...

Me encanta, te han quedado geniales.

Besos

Raquel dijo...

Ay Susana que cosas mas ricas me pones y que fotos me encantan... voy y vengo sin tiempo ni cuerpo para casi nada pero no podía dejar de desearte buen veranico.
Besos fuertes.

Yolanda dijo...

¡Qué pinta más extraordinaria, chica! En el corte se ven estupendísimos, tan esponjosos que me pongo a llorar de pensar que no puedo probarlos. Así que habrá que hacerlos, que para eso no hay pereza. Además leyendo la receta, se ven tan fácil de hacer ...

Un besote.

Anita Cocinitas dijo...

Ay! Que me han tentado también estos muffins!
¿Sabes si se puedes hacer con levadura en polvo?
(Igual es lo mismo y estoy quedando como la paleta que soy...)
Un saludo!

Clemenvilla dijo...

Anita: la levadura química es levarura en polvo o royal que es la marca más conocida.

Anita Cocinitas dijo...

Ay... que me lo estaba imaginando! Muchas gracias!

Anita Cocinitas dijo...

Ay... mi primer experimento un poco frustrado...
Pero están buenísimas!
Gracias!
un saludo

Clemenvilla dijo...

Anita: qué te h pasado, no se te habrán espachurrado por los moldes, cuéntame el problema que has tenido.... pero me alegro que popr lo menos estén buenos.
Un besito

Anita Cocinitas dijo...

Se me han espachurrado, si! Que penita... bueno, puedes ver la catástrofe en mi blog!
Pero no me rindo y seguiré intentándolo!
Un beso

Maru dijo...

Los muffins de zanahoria son increibles! yo los he probado en mi ultimo viaje en Miami y ahora en Buenos Aires no los puedo conseguir... asi que gracias por pasar la receta :)